Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification
(2014)- Abstract
- The importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several critical steps that may influence the yield and quality of the final product, especially in the lysis, clarification and purification steps.
The lysis process is the first critical step, since it can be detrimental to the nucleic acids and it also can release all the content from the cells by its disruption. A new approach was developed in... (More) - The importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several critical steps that may influence the yield and quality of the final product, especially in the lysis, clarification and purification steps.
The lysis process is the first critical step, since it can be detrimental to the nucleic acids and it also can release all the content from the cells by its disruption. A new approach was developed in order to minimize this effect and reduce the main host cell contaminants. The electropermeability approach for extraction of small nucleic acids from bacteria avoids complete cell disruption and thereby reduces contaminants for the next stages.
The clarification and concentration steps are normally done to remove most of the contaminants from the cell lysis steps. In this thesis an aqueous two-phase system (ATPS) approach based on poly(ethylene glycol)/poly(acrylate)/salt two phase system is described. This method allows the handling of large volumes, which is important in the preparative industrial scale. ATPS resulted in a pure plasmid DNA directly from crude cell lysates. In addition, smaller DNA fragments from Polymerase Chain Reaction (PCR) can be isolated using this method.
The regular downstream process is normally finished by chromatographic approaches, which often are the main final purification step. DNA molecules harbour some intrinsic chemical properties that render them suitable for chromatographic separations. These include a negatively charged phosphate backbone as well as a hydrophobic character originating mainly from the major groove of DNA which exposes the base pairs on the surface of the molecule. In addition, single stranded DNA often allows for a free exposure of the hydrophobic aromatic bases. In this thesis, multimodal chromatography (MMC) was evaluated as an alternative tool for complex separations of nucleic acids. MMC embraces more than one kind of interaction between the chromatographic ligand and the target molecules. This resin demonstrated a superiority for DNA isolation, including in the purification of pDNA from crude cell lysate and for DNA fragments from PCR samples. (Less) - Abstract (Swedish)
- Popular Abstract in English
...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to how the combination of letters form words. Genes, long DNA molecules, are how living organisms receive features from their ancestors. The sequence of DNA molecules of many different organisms is now known, including the human genome completed in 2003. The studies of the human genome are revealing disease origins and other biochemical... (More) - Popular Abstract in English
...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to how the combination of letters form words. Genes, long DNA molecules, are how living organisms receive features from their ancestors. The sequence of DNA molecules of many different organisms is now known, including the human genome completed in 2003. The studies of the human genome are revealing disease origins and other biochemical mysteries. As a consequence of this, scientists came closer to new and better means of diagnosing and treating genetic disorders. The genetic disorders are diseases caused by one or more abnormalities in the genes, from hereditary origin and/or caused by the environment. The appearance of gene therapy, i.e. the insertion in the cells of the new genes missing, or by the expression of a precise gene sequence that produces a specific protein missing, opened new perspectives of treatments. The common process for the production of these therapeutic genes is bacteria-based. Therefore, efficient methods for recovery and purification of these products are needed in order to fulfill basic patterns for being acceptable for gene therapy use. Starting with electropermeability extraction of nucleic acids as a recovery approach, by clarification with aqueous two-phase systems and multimodal chromatographic methods for DNA purification were the aims of this thesis. (Less)
Please use this url to cite or link to this publication:
https://lup.lub.lu.se/record/4228198
- author
- Matos, Tiago LU
- supervisor
- opponent
-
- Dr. Podgornik, Ales, Centre of Excellence for Biosensors, Instrumentation and Process Control - COBIK, Slovenia
- organization
- publishing date
- 2014
- type
- Thesis
- publication status
- published
- subject
- pages
- 162 pages
- defense location
- Lecture hall B, at the Centre for Chemistry and Chemical Engineering, Getingevägen 60, Lund University Faculty of Engineering
- defense date
- 2014-01-31 10:00:00
- ISBN
- 978-91-7422-342-2
- language
- English
- LU publication?
- yes
- id
- 89bd60e5-f7af-4184-99ba-a9b02c9124d7 (old id 4228198)
- date added to LUP
- 2016-04-04 13:59:52
- date last changed
- 2018-11-21 21:17:39
@phdthesis{89bd60e5-f7af-4184-99ba-a9b02c9124d7,
abstract = {{The importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several critical steps that may influence the yield and quality of the final product, especially in the lysis, clarification and purification steps.<br/><br>
The lysis process is the first critical step, since it can be detrimental to the nucleic acids and it also can release all the content from the cells by its disruption. A new approach was developed in order to minimize this effect and reduce the main host cell contaminants. The electropermeability approach for extraction of small nucleic acids from bacteria avoids complete cell disruption and thereby reduces contaminants for the next stages.<br/><br>
The clarification and concentration steps are normally done to remove most of the contaminants from the cell lysis steps. In this thesis an aqueous two-phase system (ATPS) approach based on poly(ethylene glycol)/poly(acrylate)/salt two phase system is described. This method allows the handling of large volumes, which is important in the preparative industrial scale. ATPS resulted in a pure plasmid DNA directly from crude cell lysates. In addition, smaller DNA fragments from Polymerase Chain Reaction (PCR) can be isolated using this method.<br/><br>
The regular downstream process is normally finished by chromatographic approaches, which often are the main final purification step. DNA molecules harbour some intrinsic chemical properties that render them suitable for chromatographic separations. These include a negatively charged phosphate backbone as well as a hydrophobic character originating mainly from the major groove of DNA which exposes the base pairs on the surface of the molecule. In addition, single stranded DNA often allows for a free exposure of the hydrophobic aromatic bases. In this thesis, multimodal chromatography (MMC) was evaluated as an alternative tool for complex separations of nucleic acids. MMC embraces more than one kind of interaction between the chromatographic ligand and the target molecules. This resin demonstrated a superiority for DNA isolation, including in the purification of pDNA from crude cell lysate and for DNA fragments from PCR samples.}},
author = {{Matos, Tiago}},
isbn = {{978-91-7422-342-2}},
language = {{eng}},
school = {{Lund University}},
title = {{Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification}},
url = {{https://lup.lub.lu.se/search/files/6255669/4229576.pdf}},
year = {{2014}},
}